About PolyMarker

PolyMarker is an automated bioinformatics pipeline for SNP assay development which increases the probability of generating homoeologue-specific assays for polyploid species. PolyMarker generates a multiple alignment between the target SNP sequence and the selected reference genome (from the drop off menu in green below). It then generates a mask with informative polymorphic positions between homoeologs which are highlighted with respect to the target genome.

These positions include (see figure for example):

PolyMarker will generate KASP assays which are based on a three primer system. Two diagnostic primers incorporate the alternative varietal SNP at the 3' end, but are otherwise similar (black boxed primers in figure). The third common primer is preferentially selected to incorporate a genome-specific base at the 3' end (red boxed primer in figure), or a semi-specific base in the absence of an adequate genome specific position.

The code of the PolyMarker pipeline is available in github.

Using PolyMarker

Example

Input file

The example input file contains three markers to design.

1DS_1905169_Cadenza0423_2404_C2404T,1D,ccgccgtcgtatggagcaggccggccaattccttcaaggagtcaaccacctggcgcaaggaccatgaggtccatgctcacgaggtctctttcgttgacgg[C/T]aaaaacaagacggcgccaggctttgagttgctcccggctgtggtggatcaccaaggcaacccgcagccgaccttggtggggatccacgttggccatcccaa 1DS_40060_Cadenza0423_2998_G2998A,1D,ccagcagcgcccgtcccccttctcccccgaatccgccggagcccagcggacgccggccatgagcacctccgagtagtaagtccccggcgccgccgccgcc[G/A]ccgatctttctttctttctcgcttgatttgtctgcgtttcttttgttccgggtgattgattgatgtgcgtgggctgctgcagcgactacctcttcaagctg 1DS_1847781_Cadenza0423_2703_G2703A,1D,tttcctctcaaatgtagcttctgcagattcggtggaagggcattcaaccggagaacctcattctcatcacttgcggtcacctctaggtaggacaaaaact[G/A]catctgaataagagactcacagaggcgttcacagtagattctcttcacattcaataacctcaggcttctcatttgcctcagctctcccagttgtctaacag

The input text box supports to have the table separated by TAB, so you can paste the three columns from excel.

Output: mask

The mask contains the details of the local alignment

Drawing